View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15523_low_26 (Length: 386)
Name: NF15523_low_26
Description: NF15523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15523_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 4e-57; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 190 - 372
Target Start/End: Complemental strand, 12808604 - 12808427
Alignment:
| Q |
190 |
caatttagaacaatattggttgtgaatgtatataaaacattgattacggatgatcatagctgaatttttatttcaattgcagacacaaattatggttgaa |
289 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12808604 |
caatttagaacaat---ggttgtgaatgtatataaaaccttgatttgggatgatcatagctgaatttttatttcaattgcagacacaaattatgattgaa |
12808508 |
T |
 |
| Q |
290 |
caaatggaagagcttcgcaaaagggtaagattaatcatcatannnnnnnncaatagctgaatttatgaaaatttagttggtcc |
372 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
12808507 |
caaatggaagagcttcgcaaaagggtaagattaatcatcat--tttttttcaatagctgaatttatgaaaatttgtttggtcc |
12808427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 24 - 160
Target Start/End: Complemental strand, 12808745 - 12808605
Alignment:
| Q |
24 |
atacatatttggtggctcttttatctatttttgttcattgatacttttcctttggttgtaaaattttcctagtgatgatataactattaaaaattaaatt |
123 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||| | ||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
12808745 |
atacatatttggtggctcttt-atctatttttgttaattgagatttttcctttggttgtaaaattttcctagttatgatataactattgaaaattaaata |
12808647 |
T |
 |
| Q |
124 |
aggtcttg-----ccagaagtttaattaactttattaaaata |
160 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
12808646 |
aggtcttgcttctctagaagtttaattaactttattaaaata |
12808605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 266 - 304
Target Start/End: Original strand, 28475263 - 28475301
Alignment:
| Q |
266 |
ttgcagacacaaattatggttgaacaaatggaagagctt |
304 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28475263 |
ttgcagacacagattatggttgaacaaatggaagagctt |
28475301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University