View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15523_low_39 (Length: 287)
Name: NF15523_low_39
Description: NF15523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15523_low_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 79; Significance: 6e-37; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 20590199 - 20590117
Alignment:
| Q |
1 |
tggatttgattctgatggagatttgagggttgttgtgtgagagagatgatcttctcatttgaacgatgttatgactttatata |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
20590199 |
tggatttgattctgatggagatttgagggttgttgtgtgagagagattatcttctcatttgaacgatgttatgactttatata |
20590117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 35 - 103
Target Start/End: Original strand, 26330878 - 26330946
Alignment:
| Q |
35 |
gtgtgagagagatgatcttctcatttgaacgatgttatgactttatataactatgtcttggtgagcaag |
103 |
Q |
| |
|
|||||||||| ||| |||||||||||||| |||| | |||||| ||| | || ||||||||||| |||| |
|
|
| T |
26330878 |
gtgtgagagatatgttcttctcatttgaatgatggtgtgacttaatagagctttgtcttggtgaacaag |
26330946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University