View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15523_low_40 (Length: 286)
Name: NF15523_low_40
Description: NF15523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15523_low_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 268
Target Start/End: Complemental strand, 13992007 - 13991740
Alignment:
| Q |
1 |
attcaaaaggtatttttggttagtctatccgtcattattggaataatacaaaggatggcatttcttccttatacgaaaaattggttatttgtatagcaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
13992007 |
attcaaaaggtatttttggttagtctatccgtcattattggaataatacaaaggatggcatttcttccttatacgaaaaattggttatttatatagcaag |
13991908 |
T |
 |
| Q |
101 |
gaaaattcacagtcctgccaattgcattcaaaataaaacttgaggaaataaccaagcatcgaaaatgcttgattttgatctactgtgacatttcttgtac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
13991907 |
gaaaattcacagtcctgccaattgcattcaaaataaaacttgaggaaataaccaagcatcgaaaatgcttgactttgatctactgtgacatttcttgtac |
13991808 |
T |
 |
| Q |
201 |
ctataataaggcctaaatttagtgagaatgcatagaagatttaatttttgctttctgtttgtactcat |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13991807 |
ctataataaggcctaaatttagtgagaatgcatagaagatttaatttttgctttctgtttgtactcat |
13991740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University