View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15523_low_55 (Length: 228)
Name: NF15523_low_55
Description: NF15523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15523_low_55 |
 | |
|
| [»] scaffold0667 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0667 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: scaffold0667
Description:
Target: scaffold0667; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 156 - 214
Target Start/End: Complemental strand, 369 - 311
Alignment:
| Q |
156 |
cagtatgttgtcgataatcattgtgaaaattcaatctgttaaattcatcttcttcttct |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
369 |
cagtatgttgtcgataatcattgtgaaaattcaatctgttaaattcatcttctttttct |
311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 206
Target Start/End: Original strand, 39266471 - 39266519
Alignment:
| Q |
158 |
gtatgttgtcgataatcattgtgaaaattcaatctgttaaattcatctt |
206 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
39266471 |
gtatgttgtcgataatcattttgaaaattcaatttgttaaattcatctt |
39266519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 206
Target Start/End: Complemental strand, 33912005 - 33911957
Alignment:
| Q |
158 |
gtatgttgtcgataatcattgtgaaaattcaatctgttaaattcatctt |
206 |
Q |
| |
|
||||||||| |||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
33912005 |
gtatgttgtggataatcattttgaaaattcaatttgttaaattcatctt |
33911957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 156 - 206
Target Start/End: Original strand, 30951784 - 30951834
Alignment:
| Q |
156 |
cagtatgttgtcgataatcattgtgaaaattcaatctgttaaattcatctt |
206 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||||| |||| |
|
|
| T |
30951784 |
cagtatgttgtcgataatcattttgaaaattcaatttgttaaattcgtctt |
30951834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 156 - 209
Target Start/End: Original strand, 23585722 - 23585775
Alignment:
| Q |
156 |
cagtatgttgtcgataatcattgtgaaaattcaatctgttaaattcatcttctt |
209 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||| |||||||||||| ||||| |
|
|
| T |
23585722 |
cagtatattgtcgataatcattttgaaaattcaatttgttaaattcattttctt |
23585775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University