View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15523_low_61 (Length: 218)
Name: NF15523_low_61
Description: NF15523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15523_low_61 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 43439964 - 43440176
Alignment:
| Q |
1 |
ttgttatttggtatcaagtatcaacatatatatcgtgactctttataatatgagcatgtcggagattcatgtatatatcaacccaattggaaataggctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43439964 |
ttgttatttggtatcaagtatcaacatatatattgtgactctttataatatgagcatgtcggagattcatgtatatatcaacccaattggaaataggctt |
43440063 |
T |
|
| Q |
101 |
taacaaagaccaagagaggccattgtctcttctatgagtggtgtattgatcctgtattttgcattggtaggccgtaggcatgcgttcccttgagcttcct |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43440064 |
taacaaagaccaagagaggtcattgtctcttctatgagtggtgtattgatcctgtattttgcattggtagggcgtaggcatgcgttcccttgagcttcct |
43440163 |
T |
|
| Q |
201 |
ttgcttctcctct |
213 |
Q |
| |
|
||| || |||||| |
|
|
| T |
43440164 |
ttgtttttcctct |
43440176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University