View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15524_high_5 (Length: 232)
Name: NF15524_high_5
Description: NF15524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15524_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 45567638 - 45567423
Alignment:
| Q |
1 |
gatgcctggtggtgatagcaagccaagccatgcctaatgattctgcttgccatgaacgtctgtcaggttcaaacacagtaaaatcagcagtagattgaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45567638 |
gatgcctggtggtgatagcaagccaagccatgcctaatgattctgcttgccatgaacgtctgtcaggttcaaacacagtaaaatcagcagtagattgaga |
45567539 |
T |
 |
| Q |
101 |
tcttgctcgaaacaattgagttgaaaatttaaacattatgatacaataatattgaaattaaaccagattggaagaaaactctgcaattatgatcttctag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45567538 |
tcttgctcgaaacaattgagttgaaaatttaaacattatgatacaataatattgaaattaaaccagattggaagaaaactctgcaattatgatcttctag |
45567439 |
T |
 |
| Q |
201 |
agtgcaaccgttgaat |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
45567438 |
agtgcaaccgttgaat |
45567423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 28 - 105
Target Start/End: Original strand, 35817542 - 35817619
Alignment:
| Q |
28 |
ccatgcctaatgattctgcttgccatgaacgtctgtcaggttcaaacacagtaaaatcagcagtagattgagatcttg |
105 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35817542 |
ccatgcctaatgagtctgcttaccatgaacgtctgtcaggttcaaacacagtaaaatcaattgtagattgagatcttg |
35817619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 110 - 190
Target Start/End: Complemental strand, 45091918 - 45091844
Alignment:
| Q |
110 |
aaacaattgagttgaaaatttaaacattatgatacaataatattgaaatt-aaaccagattggaagaaaactctgcaattat |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| |||||||||| |||| || |||||||||||| |
|
|
| T |
45091918 |
aaacaattgagttgaaaatttaaacattatg-------aatattgaaattgaaaccagatttgaagcaacctctgcaattat |
45091844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University