View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15524_low_10 (Length: 309)
Name: NF15524_low_10
Description: NF15524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15524_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 4e-69; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 158 - 290
Target Start/End: Complemental strand, 49890492 - 49890360
Alignment:
| Q |
158 |
gcttagaatgtgattgtaatgttagttttgcttcctataacttattaggtatcaaaagtttgttgcttattgatttgttctcttattgtaatcttgatta |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49890492 |
gcttagaatgtgattgtaatgttagttttgcttcctataacttattaggtatcaaaagtttgttgcttattgatttgttctcttattgtaatcttgatta |
49890393 |
T |
|
| Q |
258 |
tgtccatgatatgcctcttaagcatgttcatag |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
49890392 |
tgtccatgatatgcctcttaagcatgttcatag |
49890360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 33 - 158
Target Start/End: Complemental strand, 49890665 - 49890539
Alignment:
| Q |
33 |
attgataacgaatttaaggaaggaggatgaacggattagattttgacccaaattaaaaaagttgtag-ttaattgagttagatttcttaagggaaaatgc |
131 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
49890665 |
attgataacgaatttaaggaaggaagatgaacggattagattttggcccaaattaaaaaagttgtagtttaattgagttagatttcttaagggaaaatgc |
49890566 |
T |
|
| Q |
132 |
tacaaatttttaattaacacagtaatg |
158 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
49890565 |
tacaaatttttaattaacacagaaatg |
49890539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University