View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15524_low_11 (Length: 274)
Name: NF15524_low_11
Description: NF15524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15524_low_11 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 7e-95; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 83 - 274
Target Start/End: Complemental strand, 24656667 - 24656477
Alignment:
| Q |
83 |
ctataggaagcgttgaattatgtatgtgcatgattcatccatctatccaaatataaataatgcatatttgataagacgtgcgtatgtatggcggctatca |
182 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24656667 |
ctataggaagcgttgaattatgtatctgcatgattcatccatctatccatatataa-taatgcatatttgataagacgtgcgtatgtatggcggctatca |
24656569 |
T |
|
| Q |
183 |
tatggtcgaaattcaacattcactcaactttgaatatttcaaataaagacaatatacaagaatttccttaaaacatcaccaaaaatgaatac |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24656568 |
tatggtcgaaattcaacattcactcaactttgaatatttcaaataaagacaatatacaagaatttccttaaaacatcaccaaaaatgaatac |
24656477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 32 - 68
Target Start/End: Complemental strand, 24656723 - 24656687
Alignment:
| Q |
32 |
ataatactacattaaaacagtttagataatttgaaat |
68 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24656723 |
ataatactacattaaaacagtttagataatttgaaat |
24656687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University