View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15524_low_9 (Length: 337)
Name: NF15524_low_9
Description: NF15524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15524_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 45 - 322
Target Start/End: Original strand, 44954618 - 44954887
Alignment:
| Q |
45 |
ccaaagtaaggtaatctcctcttccatgatgtgaagagggatgaaggaaaaggcaagtcatgaaggcaaagggaaggtaacgcctttcttccaggatcaa |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44954618 |
ccaaagtaaggtaatctcctcttccatgatgtgaagagggatgaaggaaaaggcaagtcatgaaggcaaagggaaggtaacgcctttcttccaggatcaa |
44954717 |
T |
|
| Q |
145 |
ttcatgtaacttagttatttatgtaacacacggattaatttcggtttattctcaaatatgtagtacnnnnnnnnnnnnnnnnnnnaaaacattaagtgct |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| ||||||| |
|
|
| T |
44954718 |
ttcatgtaacttagttatttatgtaacacacggattaatttcggtttattctcaaatatgtact--------tttgttttgttttaaaacatgaagtgct |
44954809 |
T |
|
| Q |
245 |
tgtgcggattgctatctatggtgattgcttatgttatgtttatttatcaaatttccttattgtgtttcatgtaatttg |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44954810 |
tgtgcggattgctatctatggtgattgcttatgttatgtttatttatcaaatttccttattgtgtttcatgtaatttg |
44954887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University