View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15525_low_13 (Length: 237)
Name: NF15525_low_13
Description: NF15525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15525_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 4616138 - 4615917
Alignment:
| Q |
1 |
agttaatcaaatcactgcagatgttagaattcaaacgtccactagtagtagtagatatacgttatgaagatactgatacagaagagcttgtgtttaagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4616138 |
agttaatcaaatcactgcagatgttagaattcaaacgtccactaatagtagtagatatacgttatgaagatgctgatacagaagagcttgtgtttaagat |
4616039 |
T |
 |
| Q |
101 |
gttttgccagtgtccttttttaatgttatttatttctagtgttagcaatatattttgccattctattttgttttcttgaacaagaaatgagggtgaatta |
200 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4616038 |
gttttgccggtgttcttttttaatgttatttatttctagtgttagcaatatattttgccattctattttgttttcttgaacaagaaatgagggtgaatta |
4615939 |
T |
 |
| Q |
201 |
atgaaatttgcttcattgtatt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
4615938 |
atgaaatttgcttcattgtatt |
4615917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University