View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15526_high_3 (Length: 237)
Name: NF15526_high_3
Description: NF15526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15526_high_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 28094459 - 28094680
Alignment:
| Q |
1 |
atacatagacattcatgagtccaaatttgaatggcttctaagacttgaaatctaagcaaccatatatcaagtnnnnnnntcccagcatgtgaaaagagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28094459 |
atacatagacattcatgagtccaaatttgaatggcttctaagacttgaaatctaagcaaccatatatcaagtaaaaaaatcccagcatgtgaaaagagat |
28094558 |
T |
 |
| Q |
101 |
gaactcttatcagttcagaatatatttgatagaattctcacgaaaatgatatacactattgtctcaggtacattacataaaaatcaaggatcaaaacaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28094559 |
gaactcttatcagttcagaatatatttgatagaattctcacgaaaatgatatacactattgtctcaggtacattacataaaaatcaaggatcaaaacaat |
28094658 |
T |
 |
| Q |
201 |
tatcatctagtccaaaacatat |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
28094659 |
tatcatctagtccaaaacatat |
28094680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 214
Target Start/End: Complemental strand, 28153147 - 28153110
Alignment:
| Q |
177 |
ataaaaatcaaggatcaaaacaattatcatctagtcca |
214 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
28153147 |
ataaaaatcaaggatcaaaacaattatgatctaatcca |
28153110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University