View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15526_low_11 (Length: 215)
Name: NF15526_low_11
Description: NF15526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15526_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 12 - 201
Target Start/End: Original strand, 13854555 - 13854744
Alignment:
| Q |
12 |
tgaaatgaaaaatttagatatgtggaggaaggtttgccaacctagatgtaaagggggcctcggtgttagagatattagattggttaatgttagcctctta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13854555 |
tgaaatgaaaaatttagatatgtggaggaaggtttgccaacctagatgtaaagggggcctcggtgttagagatattagattggttaatgttagcctctta |
13854654 |
T |
 |
| Q |
112 |
gctaagtggtggtggcggctcctacaagatcaaccgtctttgtggaaagaggtgcttgaagatatttatggacctagggtgagttctagg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13854655 |
gctaagtggtggtggcggctcctacaagatcaatcgtctttgtggaaagaggtgcttgaagatatttatggacctagggtgagttctagg |
13854744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 34 - 104
Target Start/End: Complemental strand, 16663923 - 16663853
Alignment:
| Q |
34 |
tggaggaaggtttgccaacctagatgtaaagggggcctcggtgttagagatattagattggttaatgttag |
104 |
Q |
| |
|
||||||||||| || ||||||||| ||||||| || || ||||| ||||| |||| |||||||||| |||| |
|
|
| T |
16663923 |
tggaggaaggtgtgtcaacctagaggtaaaggtgggcttggtgtgagagacattaaattggttaatattag |
16663853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University