View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15528_high_5 (Length: 341)
Name: NF15528_high_5
Description: NF15528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15528_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 93 - 334
Target Start/End: Original strand, 44428256 - 44428496
Alignment:
| Q |
93 |
ctttgttggagggtcgtacagtaagggtgggacggagtgttagttgttttaactatagaatttacattttgataataagcaagttggtcataaagaagca |
192 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44428256 |
ctttgttggagggtcgtatagtaagggtgggacggagtgttagttgttttaactatagaatttacattttgataataagcaagttggtcataaagaagca |
44428355 |
T |
|
| Q |
193 |
agttcgtggcatgtttatcctgtgttctcccagtaaagcagtgtgacaacaaatagatctgtggcagcacaacgagtccttttgcttctggcagtgtaaa |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44428356 |
agttcgtggcatgtttatcctgtgttctcccagtaaagcagtgtgacaacaaatagatctgtggcagca-aacgagtccttttgcttctggcagtgtaaa |
44428454 |
T |
|
| Q |
293 |
gtttttcagtgaatgaagctaactaaccaagcgatctctgct |
334 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
44428455 |
gtttttcagtgaatgaggctaactaaccaagcaatctctgct |
44428496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 15 - 76
Target Start/End: Original strand, 44428206 - 44428267
Alignment:
| Q |
15 |
cacatttttgacaaatttaatactacatcaaatttctcagtatccgtaaactttgtcggagg |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44428206 |
cacatttttgacaaatttaatactacatcaaatttctcagtatccgtaaactttgttggagg |
44428267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University