View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15529_high_3 (Length: 294)
Name: NF15529_high_3
Description: NF15529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15529_high_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 7 - 260
Target Start/End: Original strand, 8615790 - 8616047
Alignment:
| Q |
7 |
ggaatagatttttgggggtggcatggggtgagaccatgaccatccattgaccatgagaaatgaaggtggnnnnnnnnnnnnnnnnnn----agtgggggt |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8615790 |
ggaatagatttttgggggtggcatggggtgagaccatgaccatccattgaccatgagaaatgaaggtgggagagagagagaaagagagagaagtgggggt |
8615889 |
T |
|
| Q |
103 |
gacgttttcatttgtttattattgaattcaattcaatatataaaaatttagatcaatgtctacaatgatgttgctagaattggtcattaccttcaataaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8615890 |
gacgttttcatttgtttattattgaattcaattcaatatataaaaatttagatcaatgtctacaatgatgttgctagaattggtcattaccttcaataaa |
8615989 |
T |
|
| Q |
203 |
atnnnnnnnngtagatgtttttggtatacacacaagtgtgagtaaggttattaccctc |
260 |
Q |
| |
|
| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8615990 |
aaataaaaaagtagatgtttttggtatacacacaagtctgagtaaggttattaccctc |
8616047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 252 - 294
Target Start/End: Original strand, 8616106 - 8616148
Alignment:
| Q |
252 |
attaccctctgcgcacaactttgaagattaatctcttgagtat |
294 |
Q |
| |
|
|||| ||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
8616106 |
attatcctctacgcgcaactttgaagattaatctcttgagtat |
8616148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University