View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15529_low_10 (Length: 207)

Name: NF15529_low_10
Description: NF15529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15529_low_10
NF15529_low_10
[»] chr8 (1 HSPs)
chr8 (1-142)||(31954077-31954218)


Alignment Details
Target: chr8 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 1 - 142
Target Start/End: Original strand, 31954077 - 31954218
Alignment:
1 tcatcataccttccattgccaccatcaaaccttcccccttcattgctgcaatccctagctatgtgacccacctcaccgcacttatagcaagcgccgcctc 100  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31954077 tcatcataccttccattgccaccatcaaaccttcctccttcattgctgcaatccctagctatgtgacccacctcaccgcacttatagcaagcgccgcctc 31954176  T
101 caccacctccgctactaggagtagcgcaatctcttgctatgt 142  Q
    ||||||||||||||||||||||||||||||||||||||||||    
31954177 caccacctccgctactaggagtagcgcaatctcttgctatgt 31954218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University