View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15529_low_3 (Length: 352)
Name: NF15529_low_3
Description: NF15529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15529_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 7 - 334
Target Start/End: Complemental strand, 45328128 - 45327801
Alignment:
| Q |
7 |
ttgttgagggtttggcttgggttgattctatttatttggctgttatgtctgttacaacggttggttatggtgatagagcttttaagacacttccgggacg |
106 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45328128 |
ttgttgagggtttggattgggttgattctatttatttggctgttatgtctgttacaacggttggttatggtgatagagcttttaagacacttccgggacg |
45328029 |
T |
|
| Q |
107 |
attgtttgcggcgatttggttgttgttttctactttgatggttgcaagggcttttctttatttagctgaagctagaattgatagaagacataggagattg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45328028 |
attgtttgcggcgatttggttgttgttttctactttgatggttgcaagggcttttctttatttagctgaagctagaattgatagaagacataggagattg |
45327929 |
T |
|
| Q |
207 |
gctaagaaggttttgcatagagaaattactattgaagattggcttgctgctgatatcaacaatactggttttatcaggtaacctaatagtccattaccct |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
45327928 |
gctaagaaggttttgcatagagaaattactattgaagattggcttgctgctgatatcaacaatactggttttattaggtaacctaatagtcctttaccct |
45327829 |
T |
|
| Q |
307 |
ctttataattataggtcaaatccatagt |
334 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
45327828 |
ctttataattataggtcaaatccatagt |
45327801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University