View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15529_low_9 (Length: 229)
Name: NF15529_low_9
Description: NF15529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15529_low_9 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 7 - 229
Target Start/End: Original strand, 7815155 - 7815377
Alignment:
| Q |
7 |
atttgatctcaataacacaggtcaagttatttggacttcacttcacgtttcattcgtgacatcattgaaggctctttctcaagccttagaactagacttc |
106 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7815155 |
atttgatctcaataacaaaggtcaagttatttggacttcacttcacgtttcattcgtgatgtcattgaaggctctttctcgagccttagaactagacttc |
7815254 |
T |
 |
| Q |
107 |
gggctttctgtgtattactaccacttgatgactttacaagtgggtaatgatgacgaggtagaatcttaaaatcggagtcgcactagtcctttaacgctat |
206 |
Q |
| |
|
|||| |||| | ||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7815255 |
gggccttctatatattactaccacttgatgactttacaagtggataatgatcacgaggtagaatcttaaaatctgagtcgcactagtcctttaacgctat |
7815354 |
T |
 |
| Q |
207 |
caagcattctagtggtgatgtgc |
229 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
7815355 |
caagcattctagtggtgatgtgc |
7815377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 43
Target Start/End: Complemental strand, 31027637 - 31027601
Alignment:
| Q |
7 |
atttgatctcaataacacaggtcaagttatttggact |
43 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
31027637 |
atttgatctcaagaacataggtcaagttatttggact |
31027601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University