View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1552_low_4 (Length: 382)
Name: NF1552_low_4
Description: NF1552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1552_low_4 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 9 - 382
Target Start/End: Original strand, 6249705 - 6250073
Alignment:
| Q |
9 |
agcaaaggttacgtttttgtggaatatttcagtacctcaatctatttggaattgtgataggatacacaattgcggcttctattagcatgacgtgatttca |
108 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6249705 |
agcaaaggttacgtttt-gtggaatatttcagtacctcaatctatttggaattgtgataggatacacaattgcggcttctattagcatgacgtgagttca |
6249803 |
T |
 |
| Q |
109 |
cannnnnnnnnatactttatacaagtaatttttaacaacataaacatgtttaggtctttttagggaagtacacattctaataatagtgttacatcttgtg |
208 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6249804 |
cattttttt--atactttatacaagtaatttttaacaacataaacatgtttaggtctttttagggaagtacacattctaataatagtgttacatcttgtg |
6249901 |
T |
 |
| Q |
209 |
cgtttatttatatcattatatattttggtttgttcacaagnnnnnnnnnnntattacatacaatctcaaattaatatgtggtatgataggaaattggttt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6249902 |
cgtttatttatatcattatatattttggtttgttcacaagaaaaacaataatattacatacaatctcaaattaatatgtggtatgataggaaattggttt |
6250001 |
T |
 |
| Q |
309 |
aacttcagtttcattggttgtttggttaacagggctatcnnnnnnnntcaaattgtttccatcaacatggggac |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6250002 |
aacttcagtttcattggttgtttggttaacagggctatc--aaaaaatcaaattgtttccatcaacatggggac |
6250073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 62; Significance: 1e-26; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 23 - 108
Target Start/End: Complemental strand, 39428909 - 39428824
Alignment:
| Q |
23 |
ttttgtggaatatttcagtacctcaatctatttggaattgtgataggatacacaattgcggcttctattagcatgacgtgatttca |
108 |
Q |
| |
|
|||||||| ||||| |||||||| ||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
39428909 |
ttttgtgggatattccagtacctaaatctatttggaattgttataggatacacaattgcggcatctattagcatgacgtgagttca |
39428824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University