View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1553-INSERTION-5 (Length: 389)
Name: NF1553-INSERTION-5
Description: NF1553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1553-INSERTION-5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 40 - 373
Target Start/End: Complemental strand, 8153649 - 8153317
Alignment:
| Q |
40 |
ggaacaagtaacttgaaatagagaagaaaaacacyctatctagatgtggatttattggatttgtgttgggaatgtttaggattttaatattaaatggaag |
139 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
8153649 |
ggaacaggtaacttgaaatagagaagaaaaacactctatctagatgtggatttattggatttgtgttgggaatgtttaggattttaatattaaatggtag |
8153550 |
T |
 |
| Q |
140 |
agtacgcagtggcttataaaagtgtgaatgtgggcccctcctttttctcggttgtctgaaatctcagggaattgcttactgcatcattcttatcttcttc |
239 |
Q |
| |
|
|||||||| | |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8153549 |
agtacgcaatagcttataaaaatgtgaatgtgggcccctcctttttctcggttgtctgaaatctcagggaattgcttactgcatcattcttatcttcttc |
8153450 |
T |
 |
| Q |
240 |
tttctttacttgcaaaacaagggagtttcactttgagattatctttcgactcactttagtcaccattacaccttgagcaaatcaaggtaaatcatatcta |
339 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
8153449 |
tttctttacttgcaaaacaagggagtttcactttgagattatctttcgactcactttagtcaccattacaccttgagcaaatcaaggtaaatcatattta |
8153350 |
T |
 |
| Q |
340 |
ctgtataatttttttaaagtagttaggattaaag |
373 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
8153349 |
ctgtataatt-ttttaaagtagttaggattaaag |
8153317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University