View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1553-INSERTION-6 (Length: 405)
Name: NF1553-INSERTION-6
Description: NF1553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1553-INSERTION-6 |
 |  |
|
| [»] chr6 (8 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 110; Significance: 3e-55; HSPs: 8)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 268 - 405
Target Start/End: Complemental strand, 10102203 - 10102066
Alignment:
| Q |
268 |
aaaataaaataagtttctttaataattaatttatgagtttgtttaaaagatatttcttgtcaataaattgtcaatcacagttctcacttcccattcatcc |
367 |
Q |
| |
|
|||| |||| || |||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
10102203 |
aaaaaaaaaaaaatttcgttaataattaatttatgagtttctttaaaagatatttcttgtcaataaattgtcaatcacagctctcactttccattcatcc |
10102104 |
T |
 |
| Q |
368 |
atccctcctctcttctctgttgttcatcttcactgcca |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10102103 |
atccctcctctcttctctgttgttcatcttcactgcca |
10102066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 254 - 318
Target Start/End: Complemental strand, 10080007 - 10079943
Alignment:
| Q |
254 |
atatcatagattataaaataaaataagtttctttaataattaatttatgagtttgtttaaaagat |
318 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||||||| ||||| ||| |||||| |
|
|
| T |
10080007 |
atatcttaaattataaaataaaataagtttctttaataattaatttaatagtttcttttaaagat |
10079943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 264 - 318
Target Start/End: Complemental strand, 10084196 - 10084142
Alignment:
| Q |
264 |
ttataaaataaaataagtttctttaataattaatttatgagtttgtttaaaagat |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| ||| |||||| |
|
|
| T |
10084196 |
ttataaaataaaataagtttctttaataattaatttaatagtttcttttaaagat |
10084142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 268 - 307
Target Start/End: Complemental strand, 10104074 - 10104035
Alignment:
| Q |
268 |
aaaataaaataagtttctttaataattaatttatgagttt |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10104074 |
aaaataaaataagtttctttaataattaatttataagttt |
10104035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 172 - 214
Target Start/End: Complemental strand, 10080091 - 10080049
Alignment:
| Q |
172 |
agccattaaatccaacggttgtaccctctttggcgtgtgaagt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
10080091 |
agccattaaatccaacggttgtaccctctttagcatgtgaagt |
10080049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 243 - 275
Target Start/End: Complemental strand, 10102250 - 10102218
Alignment:
| Q |
243 |
acctttgcttaatatcatagattataaaataaa |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
10102250 |
acctttgcttaatatcatagattataaaataaa |
10102218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 172 - 214
Target Start/End: Complemental strand, 10084287 - 10084245
Alignment:
| Q |
172 |
agccattaaatccaacggttgtaccctctttggcgtgtgaagt |
214 |
Q |
| |
|
|||||||||||||||||| |||||||||||| || |||||||| |
|
|
| T |
10084287 |
agccattaaatccaacgggtgtaccctctttagcatgtgaagt |
10084245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 172 - 214
Target Start/End: Complemental strand, 10096745 - 10096704
Alignment:
| Q |
172 |
agccattaaatccaacggttgtaccctctttggcgtgtgaagt |
214 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
10096745 |
agccattaaatccaacggttgta-cctctttggcatgtgaagt |
10096704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University