View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1553-Insertion-14 (Length: 242)
Name: NF1553-Insertion-14
Description: NF1553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1553-Insertion-14 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 7 - 242
Target Start/End: Complemental strand, 32566895 - 32566660
Alignment:
| Q |
7 |
agctcggatactttagattgagaaagtgtctgctgtgtgttgcggcgtacactcatatgacagtgacacatgtgattacatacaattgcttctattttct |
106 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32566895 |
agctcagatactttagactgagaaagtgtctgctgtgtgttgcggcgtacactcacatgacagtgacacatgtgattacatacaattgcttctattttct |
32566796 |
T |
|
| Q |
107 |
aaaatcattgctgctcggacactttagaggagtttaatcttaaacatataataaataactctacatgattggttcatattagatttaagtaaaactaatt |
206 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32566795 |
aaaattattgctgctcggacactttagaggagtttaatcttaaacatataataaataactctacatgattggttcatattagatttaagtaaaactaatg |
32566696 |
T |
|
| Q |
207 |
ttgatcttacatgttgacattacacaaaattagttc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
32566695 |
ttgatcttacatgttgacattacacaaaattagttc |
32566660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University