View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1553-Insertion-15 (Length: 226)
Name: NF1553-Insertion-15
Description: NF1553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1553-Insertion-15 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 8 - 226
Target Start/End: Original strand, 21269870 - 21270088
Alignment:
| Q |
8 |
gatacctccctacaaagattttccctttcttccactataaatactggaaaatggttaacagcttggaagcacagcagcaacattcaattctacagctaat |
107 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21269870 |
gatacctccctactaagattttccctttcttccactataaatactggacaatggttaacagcttggaagcacagcagcaacattcaattctacagctaat |
21269969 |
T |
|
| Q |
108 |
ttcattttcttcaacaaaaccaaacaaacatgtcaagctcatgcggcaactgcgactgcgctgacaagagccagtgcgggtaagtgctcctctatcttgt |
207 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21269970 |
ttcattttcatcaacaaaaccaaacaaacatgtcaagctcatgcggcaactgcgactgcgctgacaagagccagtgcgggtaagtgctcctctatcttgt |
21270069 |
T |
|
| Q |
208 |
actgcaaggttgatgtgta |
226 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
21270070 |
actgcaaggttgatgtgta |
21270088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University