View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1553-Insertion-16 (Length: 213)
Name: NF1553-Insertion-16
Description: NF1553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1553-Insertion-16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 8 - 212
Target Start/End: Complemental strand, 6036172 - 6035968
Alignment:
| Q |
8 |
taaccgaccctcactaaatactaaataactaactgattttcgtctggtcctctgacagaatcaacatcctctaataaaaacgaatggctgagatgatctt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
6036172 |
taaccgaccctcactaaatactaaataactaactaattttcgtctggtgctctgacagaatcaacatcctctaataaaaacgaacggttgagatgatctt |
6036073 |
T |
 |
| Q |
108 |
taatgttagacattccatactcgatatactcgtttgcatttctaccaacaacatctaccaattataagtttcaatatgccgggaacaaaatgctttctat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6036072 |
taatgttagacattccatactcgatatactcgtttgcatttctaccaacaacatctaccaattataagtttcaatatgccggaaacaaaatgctttctat |
6035973 |
T |
 |
| Q |
208 |
ctaaa |
212 |
Q |
| |
|
||||| |
|
|
| T |
6035972 |
ctaaa |
6035968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University