View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15530_low_3 (Length: 253)
Name: NF15530_low_3
Description: NF15530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15530_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 12 - 234
Target Start/End: Original strand, 7235556 - 7235778
Alignment:
| Q |
12 |
agagagggatagtatagtgtgtgtattgaagtgaggattctatggtacttcttgatccaatggtttcagatttatccatgtcagcattctctatagagtg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7235556 |
agagagggatagtatagtgtgtgtattgaagtgaggattctatggtacttcttgatccaatggtttcagatttatccatgtcagcattctctatagagtg |
7235655 |
T |
|
| Q |
112 |
ttatcattataatttcacaatttattcacctttctaactttctttttaaccnnnnnnnngttaatcttggtagttagttagtacaaatgcacacacactc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7235656 |
ttatcattataatttcacaatttattcacctttttaactttctttttaaccttttttttgttaatcttggtagttagttagtacaaatgcacacacactc |
7235755 |
T |
|
| Q |
212 |
ttcaactcaaaggttccactctt |
234 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
7235756 |
ttcaactcaaaggttccactctt |
7235778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University