View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15531_low_19 (Length: 285)
Name: NF15531_low_19
Description: NF15531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15531_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 19 - 276
Target Start/End: Original strand, 35074715 - 35074972
Alignment:
| Q |
19 |
gatagtgaatttgagtttgcggtggtttcgagggattcaacgaatttctcagtggtttccgccgatgacattttctacaacggtcagatcaaacctttgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35074715 |
gatagtgaatttgagtttgcggtggtttcgagggattcaacgaatttctccgtggtttccgccgatgacattttctacaacggtcagatcaaacctttgt |
35074814 |
T |
|
| Q |
119 |
attatccagtttttgatcaaaatctactaaacgacgacgatgacggtgccgtttcttccgtttcgccggttccgaacgaaacaacaacacgacgtcgttt |
218 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35074815 |
attatccagttttcgatcaaaatctactaaacgacgacgatgacggtgtcgtttcttccgtttcgccggttccgaacgaaacaacaacacgacgtcgttt |
35074914 |
T |
|
| Q |
219 |
accgctacgaacgctgatgtttgaagaaagcagcgaagctacggcatcgtgttcatct |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35074915 |
accgctacgaacgctgatgtttgaagaaagcagcgaagctacggcatcgtgttcatct |
35074972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 76 - 113
Target Start/End: Original strand, 43903068 - 43903105
Alignment:
| Q |
76 |
tccgccgatgacattttctacaacggtcagatcaaacc |
113 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43903068 |
tccgccgatgacattttccacaacggtcagatcaaacc |
43903105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University