View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15531_low_34 (Length: 211)
Name: NF15531_low_34
Description: NF15531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15531_low_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 20 - 172
Target Start/End: Original strand, 38366315 - 38366471
Alignment:
| Q |
20 |
aggaacgcgtcatcctttcttctaagaccatggaggcagaggagattgttgaacgatcaaagtgatttttagctaggagcaaagcgggatcttgtat--- |
116 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38366315 |
aggaacacgtcatcctttcttctaagaccatggaggcagaggagattgttgaacgatcaaagtgatttttagctaggagcaaagcgggatcttgtatgta |
38366414 |
T |
|
| Q |
117 |
-gtactatgaatgattttcaaactctttgatttgtattttgtcgcgatttagttagg |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38366415 |
cgtactatgaatgattttcaaactctttgatttgtattttgtcgcgatttagttagg |
38366471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 109 - 154
Target Start/End: Complemental strand, 2615842 - 2615797
Alignment:
| Q |
109 |
tcttgtatgtactatgaatgattttcaaactctttgatttgtattt |
154 |
Q |
| |
|
|||| |||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
2615842 |
tcttatatgtactatgaatgatttttaaatcctttgatttgtattt |
2615797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University