View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15532_high_14 (Length: 320)
Name: NF15532_high_14
Description: NF15532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15532_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 304
Target Start/End: Complemental strand, 38944911 - 38944612
Alignment:
| Q |
1 |
ttaactagattttatttacgaaaaagttgagccaatagaagttgatatctacttctt-tgttgaccaaactttatactataggaccggaggtagtaccta |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38944911 |
ttaactagattttatttacgaaaaagttgagtcaatagaagttgatatctacttcttctgttgaccaaactttatactataggattggaggtagtaccta |
38944812 |
T |
 |
| Q |
100 |
atattggttgaactttggaagctcaaagatattaattactaatttatggtgatattgttgggattattaaatttgccactatattgaaatgtgctagcta |
199 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38944811 |
---ttggttgaactttggaagttcaaagatattaattactaatttatggtgatattgttgggattattaaatttgccgctatattgaaatgtgctagcta |
38944715 |
T |
 |
| Q |
200 |
gtgaattgaaagttgcaacaactctatccaatttttgactcaattatttaatattggttccccattcaatgcaggtgatgagaaagccttagcagacgat |
299 |
Q |
| |
|
||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38944714 |
gtg--ttgaaagttgtaacaactctatccaatttttgactcaattatttaatattggttccccattcaatgcaggtgatgagaaagccttagcagacgat |
38944617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University