View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15532_high_19 (Length: 255)
Name: NF15532_high_19
Description: NF15532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15532_high_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 32861622 - 32861848
Alignment:
| Q |
1 |
ccatggttttaaattgtggttgcgtatgcggttgcggttgcggacacaacgattgtggacattgcagttgttgcgatgcttattgcagtcattgcagcgt |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
32861622 |
ccatggttttaaattgtggtcgcgtatgcggttgcgg------acacaacgattgtggacattgcagttgttgcaatgcttattgcagtcgttgcagcgt |
32861715 |
T |
 |
| Q |
101 |
ggacacgacactgatattgacatattgactggtaaaaatttaagaaaatgaacgtaatcacatgtgttgttgtcggatattagacatgcccttgatcaaa |
200 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
32861716 |
ggacacgac-ctgatattgag--------tggtaaaaatttaagaaaatgaacgtaatcacatgtgttgttgtcggatattggacatgcctttgatcaaa |
32861806 |
T |
 |
| Q |
201 |
ggtattagtgatataaagttcacaagtctctcatttcatctc |
242 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32861807 |
ggtattagtgatataaagttcacatgtctctcatttcatctc |
32861848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University