View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15532_low_16 (Length: 286)
Name: NF15532_low_16
Description: NF15532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15532_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 2e-55; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 141 - 278
Target Start/End: Complemental strand, 7907794 - 7907657
Alignment:
| Q |
141 |
caattattcataatgtcataannnnnnnncatataattaatcatactatcaaatttgcatgatgatgtcacttttgtcatgtcatcaacagtattgtcat |
240 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7907794 |
caattattcataatgtcacaattttttttcatataattaatcatactatcaaatttgcatgatgatgtcacttttgtcatgtcatcaacagtattgtcat |
7907695 |
T |
 |
| Q |
241 |
gtttctgatttttgcaccgtccaattatttttcttctc |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7907694 |
gtttctgatttttgcaccgtccaattatttttcttctc |
7907657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 18 - 97
Target Start/End: Complemental strand, 7907976 - 7907898
Alignment:
| Q |
18 |
atttgtctccacgaaacaaatgatatggtcaatgtcggtacgacgaaattaagaaaaaattgaaatgagttaagttttga |
97 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7907976 |
atttgtctccacgaaacaa-tgatatggtcaatgtcggtacgacgaaattaagaaaaaatataaatgagttaagttttga |
7907898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 93 - 133
Target Start/End: Complemental strand, 7907823 - 7907783
Alignment:
| Q |
93 |
tttgaataaaacttgtatgagtcttcattcaattattcata |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7907823 |
tttgaataaaacttgtatgagtcttcattcaattattcata |
7907783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University