View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15532_low_21 (Length: 252)
Name: NF15532_low_21
Description: NF15532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15532_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 19 - 238
Target Start/End: Complemental strand, 36065501 - 36065282
Alignment:
| Q |
19 |
tctatctctcccaaccagcctaactcgtcgtccaagaccaagtgacctgcaaatttctcatccggttcaaccgggtctggttcggttttcttgagggaga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36065501 |
tctatctctcccaaccagcctaactcgtcgtccaagaccaagtgacctgcaaatttctcatccggttcaaccgggtctggttcggttttcttgagggaga |
36065402 |
T |
|
| Q |
119 |
gtcttgttgtagtttttgaaactggccatgcatggttgtggtcggaggagtaggttatgatgagcattgtggggtccacacggcttctttctacttgttt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36065401 |
gtcttgttgtagtttttgaaactggccatgcatggttgtggtcggaggagtaggttatgatgagcattgtggggtccacacggcttctttctacttgttt |
36065302 |
T |
|
| Q |
219 |
ccttgctggacaacctttgc |
238 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
36065301 |
ccttgctggacaacctttgc |
36065282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 168 - 236
Target Start/End: Original strand, 35202732 - 35202800
Alignment:
| Q |
168 |
gtaggttatgatgagcattgtggggtccacacggcttctttctacttgtttccttgctggacaaccttt |
236 |
Q |
| |
|
|||||||| || ||| ||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
35202732 |
gtaggttacgaggaggtttgtggggtccacacggcttctttcgacttgttttcttgctggacaaccttt |
35202800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University