View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15533_high_6 (Length: 254)
Name: NF15533_high_6
Description: NF15533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15533_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 189
Target Start/End: Original strand, 23612406 - 23612590
Alignment:
| Q |
1 |
ttggattcaccgaggagtgaacaccctattgtcattcaaattctagtactcttttgaacatagaaagttctccatttgcatggcacgatagtaataatgg |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23612406 |
ttggattcgccgaggagtgaacaccctattgtcattcaaattctagtactcttttgaacatagaaagttctccattagcatggcacgatagtaataatgg |
23612505 |
T |
 |
| Q |
101 |
ccgtcgaatttgggtatcgccggttgttggaaattgctcgtttctgccatgatcgatcattcttgattgctttctttcactcctgcttt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
23612506 |
ccgtcgaatttgggtatcgccggttgttggaaattgctcgtttctgtcat----gatcattcttgattgctttctttcactcctgcttt |
23612590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 172 - 240
Target Start/End: Original strand, 23612606 - 23612674
Alignment:
| Q |
172 |
ttctttcactcctgctttacgtactcaaaaactacgtttttgtttgctcggtccccaaatgtacctatg |
240 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
23612606 |
ttctttcactcctgctttacatactcaaaaactacgtttttgtttgatcggtccccaaatgtagctatg |
23612674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University