View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15534_high_8 (Length: 213)
Name: NF15534_high_8
Description: NF15534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15534_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 102 - 199
Target Start/End: Complemental strand, 3651459 - 3651367
Alignment:
| Q |
102 |
acacttagatataggtatgttgttcttcttgcttgaagctcctttgatttgattactatttcattttattttgctctacatatcaaagttaatttgtg |
199 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3651459 |
acacttagatttaggtatgttgttcttcttgcttgaagctcctttgatttgattactatttca-----ttttgctctacatatcaaagttaatttgtg |
3651367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 102 - 150
Target Start/End: Original strand, 3677700 - 3677748
Alignment:
| Q |
102 |
acacttagatataggtatgttgttcttcttgcttgaagctcctttgatt |
150 |
Q |
| |
|
|||||||||||||||| | ||||| || |||||||||||| |||||||| |
|
|
| T |
3677700 |
acacttagatataggtctattgttgttgttgcttgaagctactttgatt |
3677748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University