View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15535_high_16 (Length: 248)
Name: NF15535_high_16
Description: NF15535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15535_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 43 - 236
Target Start/End: Original strand, 31061481 - 31061672
Alignment:
| Q |
43 |
tgctatttacaagattctcacgtttctctattatttttctcagagaaaaataaaatagagtgataggatggtggaaagactttagaaattagagatcaat |
142 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31061481 |
tgctatttacaagattctcacgtttctctgttatttttctcatagaaaaataaaatagagtgataggatggtggaaagactttagaaattagagatcaat |
31061580 |
T |
 |
| Q |
143 |
gttcatnnnnnnnnnnttatatttatctctctctaacatatgttggcagagcttaaacccgaaacctctgtaattttttaggaaaattggctct |
236 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31061581 |
gttcat--aaaaaaaattatatttatctctctctaatatatgttggtagagcttaaacccgaaacctctgtaattttttaggaaaattggctct |
31061672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University