View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15535_low_23 (Length: 223)
Name: NF15535_low_23
Description: NF15535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15535_low_23 |
 |  |
|
| [»] scaffold0155 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 11 - 122
Target Start/End: Complemental strand, 2662707 - 2662596
Alignment:
| Q |
11 |
tcgaagaatataaagagaacaaaaaattaacacctaaggtcttcatgatcttcatctttttatccatgtcaacaaacagtgtgatcaaaatgcaaacaaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2662707 |
tcgaagaatataaagagaacaaaaaattaacacctatggtcttcatgatcttcatctttttatccatgtcaacaaacagtgtgatcaaaatgcaaacaaa |
2662608 |
T |
 |
| Q |
111 |
cattatgacatc |
122 |
Q |
| |
|
|||||||||||| |
|
|
| T |
2662607 |
cattatgacatc |
2662596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0155 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: scaffold0155
Description:
Target: scaffold0155; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 11 - 122
Target Start/End: Complemental strand, 37947 - 37836
Alignment:
| Q |
11 |
tcgaagaatataaagagaacaaaaaattaacacctaaggtcttcatgatcttcatctttttatccatgtcaacaaacagtgtgatcaaaatgcaaacaaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37947 |
tcgaagaatataaagagaacaaaaaattaacacttatggtcttcatgatcttcatctttttatccatgtcaacaaatagtgtgatcaaaatgcaaacaaa |
37848 |
T |
 |
| Q |
111 |
cattatgacatc |
122 |
Q |
| |
|
|||||||||||| |
|
|
| T |
37847 |
cattatgacatc |
37836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University