View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15536_low_14 (Length: 287)
Name: NF15536_low_14
Description: NF15536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15536_low_14 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 287
Target Start/End: Original strand, 1027741 - 1028030
Alignment:
| Q |
1 |
tatgctggatccattaacgatttacatagatcttcaaaaccatatcctagttattctgaatatgatccagcaaattggtgctgcaatattgtcattgcac |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1027741 |
tatgttggatccattaacgatttacatagatcttcaaaaccatatcctagttatcctgaatatcatccagcaaattggtgctgcaatattgtcattgcac |
1027840 |
T |
 |
| Q |
101 |
tttgttgtaattcatagtctaaagcatagcatgatgtatcgcaaaaataataagaattaaaaattcaactacatcatctcacaaagaaatgaataaaact |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1027841 |
tttgttgtaattcatagtctaaagcaaagcatgatgtatcgcaaaaataataagaattaaaaattcaactacatcatctcacaaagaaatgaataaaact |
1027940 |
T |
 |
| Q |
201 |
ttag---nnnnnnnncctaatgttttacggtattcaactttgcagtgtgttttatgtgtgtgtccaaatactgttgatatgggtagtgct |
287 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
1027941 |
ttagtttttttttttcctaatgttttacggtattcaactttgcagtgtgttttatgtgtgtgtccaaacactgttgatttgggtagtgct |
1028030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 136 - 174
Target Start/End: Original strand, 1025525 - 1025563
Alignment:
| Q |
136 |
gtatcgcaaaaataataagaattaaaaattcaactacat |
174 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
1025525 |
gtatcgcaaaaataatcagaattaaaaattcacctacat |
1025563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University