View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15536_low_19 (Length: 208)
Name: NF15536_low_19
Description: NF15536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15536_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 19 - 186
Target Start/End: Original strand, 51418409 - 51418576
Alignment:
| Q |
19 |
catagggaaagcactgaacaacgtgatggtgaagcaccatgaagcactcacgtgccgtccacgtgatgctgatatgtatttcatttcaccgttggagtat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
51418409 |
catagggaaagcactgaacaacgtgatggtgaagcaccatgaagcactcacgtgccgtccacgtgatgctgatatgtattttatttcaccgttggagtat |
51418508 |
T |
 |
| Q |
119 |
cagttcagctgtagcagcagtccaccgcgtctctctcgtggtgtaaacagtagtaggaggaagctatt |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
51418509 |
cagttcagctgtagcagcagtccaccgcgtctctctcgtggtgcaaacagtagtaggaggaagctatt |
51418576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 19 - 161
Target Start/End: Original strand, 51413356 - 51413498
Alignment:
| Q |
19 |
catagggaaagcactgaacaacgtgatggtgaagcaccatgaagcactcacgtgccgtccacgtgatgctgatatgtatttcatttcaccgttggagtat |
118 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51413356 |
catagggaaagcattgaacagcgtgatggtgaagcaccatgaagcactcacgtgccgaccacgtgatgctgatatgtatttcatttcaccgttggagtat |
51413455 |
T |
 |
| Q |
119 |
cagttcagctgtagcagcagtccaccgcgtctctctcgtggtg |
161 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||| |||| |
|
|
| T |
51413456 |
cagttcagctgtagtagcagtccacctcgtctctctcgcggtg |
51413498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 89 - 158
Target Start/End: Original strand, 51416472 - 51416541
Alignment:
| Q |
89 |
gatatgtatttcatttcaccgttggagtatcagttcagctgtagcagcagtccaccgcgtctctctcgtg |
158 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||||||||| |||||||| |||| |||||| |
|
|
| T |
51416472 |
gatatgtatttcgtttcaccgttggaatatcagttcagctgtagcagcaatccaccgcatctcactcgtg |
51416541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 59; Significance: 3e-25; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 50 - 120
Target Start/End: Original strand, 29323690 - 29323760
Alignment:
| Q |
50 |
aagcaccatgaagcactcacgtgccgtccacgtgatgctgatatgtatttcatttcaccgttggagtatca |
120 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29323690 |
aagcaccacgaagcactcatgtgccgtccacgtgatgctgatatgtatttcgtttcaccgttggagtatca |
29323760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University