View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15537_high_3 (Length: 484)
Name: NF15537_high_3
Description: NF15537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15537_high_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 414; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 414; E-Value: 0
Query Start/End: Original strand, 1 - 471
Target Start/End: Original strand, 13793007 - 13793480
Alignment:
| Q |
1 |
tttgacggtttctgtggaggacataactatggtagttattcggcccaattttaaggacattattgggccgtggattttggagagttttgcgagggtttgg |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13793007 |
tttgacagtttctgtggaggacataactatggtagttattcggcccaattttaaggacattattgggccgtggattttggagagttttgcgagggtttgg |
13793106 |
T |
|
| Q |
101 |
tggggcttttgacccagttgatggagattgcctatgatggggaggccacgtggacccggtggaagtcgaggtttgtgttttatgagaaaggaatagagga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13793107 |
tggggcttttgacccagttgatggagattgcctatgatggggaggccacgtggacccggtggaagtcgaggtttgtgttttatgagaaaggaatagagga |
13793206 |
T |
|
| Q |
201 |
tttggaggaagatgaagatgaagagaatgaggagtgtggtgttgagtgtgtccatttgttgttgttgttttggcagagaaagttgaagaaggagaagaag |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13793207 |
tttggaggaagatgaagatgaagagaatgaggagtgtagtgttgagtgtgtccatttgttgttgttgttgtggcagagaaagttgaagaaggagaagaag |
13793306 |
T |
|
| Q |
301 |
agattggaggtttttctttgttgctaagggcacatgttc-ttaagattttatagtgttattttatttagtgttgcta--ttannnnnnnactatctctct |
397 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
13793307 |
agattggaggtttttctttgttgctaagggcacatgttctttaagattttatagtgttattttatttagtgttgctattttttttttttactatctctct |
13793406 |
T |
|
| Q |
398 |
gattcgtgagttagcaatctcaagataaacgtgagaggaaataaaatttgattaaaagttattattatagatat |
471 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13793407 |
gattcgtgagttagcaatctcaagataaacgtgagaagaaataaaatttgattaaaagttattattatagatat |
13793480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University