View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15537_high_6 (Length: 296)
Name: NF15537_high_6
Description: NF15537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15537_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 20 - 286
Target Start/End: Original strand, 42273339 - 42273605
Alignment:
| Q |
20 |
aactttacattatttgtgcaacaaatattgctctaagttgaaaatttacagctcttgatgagcaacttgttggtttggcgtctctgaacatgctttcaag |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42273339 |
aactttacattatttgtgcaacaaatattgctcaaaattgagaatttacagctcttgatgagcaacttgttggtttggcgtctctgaacatgctttcaag |
42273438 |
T |
 |
| Q |
120 |
ttgcttaagctctctatccagattctatcagctacaattgcatccttgtcgttgttgcgatgccatgaccaatgtgcatgagtttcattcagtattcgta |
219 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42273439 |
ttgcttaagctctctatccagattccatcagctacaattgcatccttgtcgttgttgcgatgccatgaccaatgtgcatgagtttcattcagtattcgta |
42273538 |
T |
 |
| Q |
220 |
accttccatgaccgaagcttggctctcgaaacaatgagagtggacttggaggattcttaaacctatg |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42273539 |
accttccatgaccgaagcttggctctcgaaacaatgagagtggacttggaggattcttaaacctatg |
42273605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 67; Significance: 8e-30; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 171 - 285
Target Start/End: Complemental strand, 26276910 - 26276796
Alignment:
| Q |
171 |
ttgttgcgatgccatgaccaatgtgcatgagtttcattcagtattcgtaaccttccatgaccgaagcttggctctcgaaacaatgagagtggacttggag |
270 |
Q |
| |
|
||||| |||||||||||||||| |||||| ||||| |||| ||||| |||||||||||||| ||||||| ||||| | ||||||||||||||||||||| |
|
|
| T |
26276910 |
ttgttacgatgccatgaccaatttgcatgtgtttcgttcactattctcaaccttccatgaccaaagcttgcctctctatacaatgagagtggacttggag |
26276811 |
T |
 |
| Q |
271 |
gattcttaaacctat |
285 |
Q |
| |
|
| ||||||||||||| |
|
|
| T |
26276810 |
gcttcttaaacctat |
26276796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University