View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15537_low_4 (Length: 340)
Name: NF15537_low_4
Description: NF15537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15537_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 85 - 338
Target Start/End: Complemental strand, 14561770 - 14561516
Alignment:
| Q |
85 |
ttatttataaggtatatttctcacaacttaattcctacgagagcaattcttgcttatagaggggttaatgtcccttcttttgtccaatctgtgagaatga |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14561770 |
ttatttataaggtatatttctcacaacttagttcctacgagagcaattcttgcttatagaggggttaatgtcccttcttttgtccaatctgttagaatga |
14561671 |
T |
|
| Q |
185 |
ggaagaatcaattttacactgttttttattttgttctcttgtaagtgatttgtggaaaggatgtgggttgaacacggttctaggaatgtgtcctcacttt |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14561670 |
ggaagaatcaattttacactgttttttattttgttctcttgtaagtgatttgtggaaaggatgtgggttgaacacggttctaggaatttgtcctcacttt |
14561571 |
T |
|
| Q |
285 |
gatagcaaatttgattgccaaagttgtgtct-gacattgatatcatcgccctttg |
338 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
14561570 |
gatagcaaatttgattgccaaagttgtgtctagatattgatatcatcgccctttg |
14561516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 27 - 93
Target Start/End: Complemental strand, 14565327 - 14565261
Alignment:
| Q |
27 |
tatatcacaatagtgttggtattgaatatggaagatggatgtttatgcaagtgtacaattatttata |
93 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14565327 |
tatatcacaatagtcttggtattgaatatggaagatggatgtttatgcaagtgtacaattatttata |
14565261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University