View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15538_low_5 (Length: 509)
Name: NF15538_low_5
Description: NF15538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15538_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 1e-79; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 1e-79
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 14658664 - 14658875
Alignment:
| Q |
1 |
ttcgatgatcatagcactaagttacttctgacctaattgatattccttttagctaaaaaccattatgtatgtttataaatttgattttacatgatcttga |
100 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||||||| ||||||||||||| ||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
14658664 |
ttcgatgatcatagtactaagttacttttgacctaattgatattctttttagctaaaaatcattatgtatgcttataaatttgattttgcatgatcttga |
14658763 |
T |
|
| Q |
101 |
ttctacaaaattgatttcagtgtaaatacatttacgttgctgctggttactcttgggtcacatataattggagagtttcacataagaagttagacttata |
200 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||| ||||||||||||||||||||| || |||||||||||||||||||||||| |||||| || |
|
|
| T |
14658764 |
ttctacaaaattgatttcagtataaatacatttacattgttgctggttactcttgggtcac--attattggagagtttcacataagaagtaagacttgta |
14658861 |
T |
|
| Q |
201 |
agcctaggattctt |
214 |
Q |
| |
|
|| ||||||||||| |
|
|
| T |
14658862 |
agtctaggattctt |
14658875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 136; E-Value: 1e-70
Query Start/End: Original strand, 193 - 384
Target Start/End: Original strand, 14659762 - 14659950
Alignment:
| Q |
193 |
gacttataagcctaggattctttcacccaataaactaatcttttgtatatattctccctttggacttgtgcacactgcacatacaatacaaatttcatca |
292 |
Q |
| |
|
||||||| | |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
14659762 |
gacttattatcctaggattctttcacccaatatactaatcttttgtatatattctccctttggacttgtgcacagtgcacata----acaaatttcatca |
14659857 |
T |
|
| Q |
293 |
gtcatattataacactactatagactcaaacttatgcgcattaattaatatagtgttacacg-gttgataaataattgagttatttaaatgga |
384 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |||| |||||||||||||| |
|
|
| T |
14659858 |
gtcatattataacactattatagactcaaacttatgcgcattaattaatatagtgttaaacgcgttgataaatcattgggttatttaaatgga |
14659950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University