View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15539_high_4 (Length: 244)
Name: NF15539_high_4
Description: NF15539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15539_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 233
Target Start/End: Complemental strand, 41305929 - 41305718
Alignment:
| Q |
18 |
tatacaccaattgtaaacttatagtgagaatttaaaatgcatctaacttgcatctttacctaatcttacatagaaaaccaatagagaaaaatatatatat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41305929 |
tatacaccaattgtaaacttatagtgagaatttaaaatacatctaacttgcatctttacctaatcttacatagaaaaccaatagagaaaaatatat---- |
41305834 |
T |
 |
| Q |
118 |
cttaatcctgcaaattagaactactgaagtaagcctgcaaaatgatccaaatgctttagcatatgttgattttgtatatcttgacagtttctctattttt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41305833 |
cttaatcctgcaaattagaactactgaagtaagcctgcaaaatgatccaaaggctttagcatatgttgattttgtatatcttgacagtttctctattttt |
41305734 |
T |
 |
| Q |
218 |
aaggtacattattcat |
233 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
41305733 |
aaggtacattattcat |
41305718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 116 - 189
Target Start/End: Complemental strand, 41333804 - 41333730
Alignment:
| Q |
116 |
atcttaatcctg-caaattagaactactgaagtaagcctgcaaaatgatccaaatgctttagcatatgttgattt |
189 |
Q |
| |
|
||||||||||| ||||||| | ||||| || || || |||||||| || ||||||||||||||||||||||||| |
|
|
| T |
41333804 |
atcttaatccttacaaattaaacctactaaaataggcgtgcaaaataatgcaaatgctttagcatatgttgattt |
41333730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 189
Target Start/End: Complemental strand, 41312073 - 41312037
Alignment:
| Q |
153 |
tgcaaaatgatccaaatgctttagcatatgttgattt |
189 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
41312073 |
tgcaaaatgatgcaaatgctttaacatatgttgattt |
41312037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University