View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1553R-Insertion-10 (Length: 134)
Name: NF1553R-Insertion-10
Description: NF1553R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1553R-Insertion-10 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 8e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 8e-62
Query Start/End: Original strand, 15 - 134
Target Start/End: Original strand, 39915535 - 39915654
Alignment:
| Q |
15 |
gtactattaaatattatatttctgaatacgtaactttcgttattgattccttagccagtgtggatactgattagtgattagcatgattcaaaaaactttt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39915535 |
gtactattaaatattatatttctgaatacgtaactttcgttattgattccttagccagtgtggatactgattagtgattagcatgattcaaaaaactttt |
39915634 |
T |
 |
| Q |
115 |
catattgttattcttagcag |
134 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
39915635 |
catattgttattcttagcag |
39915654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University