View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1553_high_17 (Length: 255)
Name: NF1553_high_17
Description: NF1553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1553_high_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 13 - 239
Target Start/End: Original strand, 28433666 - 28433897
Alignment:
| Q |
13 |
gaataaaattgaataatgtcaatattgttaaagtaatttcgtacttattttttggaacataggacagccaccctactcgctctacctcagatacggcctt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | |||||||||| ||||||||||||||||||| | |
|
|
| T |
28433666 |
gaataaaattgaataatgtcaatattgttaaagtaatttcgtacttattttttggggcataggacggtcaccctactcactctacctcagatacggcc-t |
28433764 |
T |
|
| Q |
113 |
gggtggaggacaacattcctttggtgaataatcaggtttgatttgcttaaactaa------atannnnnnnnnngcggttgttactaaaccatgttccga |
206 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
28433765 |
gggcggaggacaacattcctttggtgaataatcaggtttgatttgcttaaactaatttttttttttttttttttgcggttgttactaaaccatgttccga |
28433864 |
T |
|
| Q |
207 |
ctaaggataacttggtaaggcggaagatttttc |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
28433865 |
ctaaggataacttggtaaggcggaagatttttc |
28433897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 228
Target Start/End: Complemental strand, 14866280 - 14866233
Alignment:
| Q |
181 |
gcggttgttactaaaccatgttccgactaaggataacttggtaaggcg |
228 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
14866280 |
gcggttgttactaaaccgtgttccgactaaggataatttggtaaggcg |
14866233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University