View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1553_high_19 (Length: 243)
Name: NF1553_high_19
Description: NF1553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1553_high_19 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 18 - 243
Target Start/End: Complemental strand, 32596936 - 32596711
Alignment:
| Q |
18 |
cgatttttcttcaggttttctcttgcagacatcatgggttacttcaatttcgatgccgagttcaaattgttacgctttcaataattcaagtcgaattgtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32596936 |
cgatttttcttcaggttttctcttgcagacatcatgggttacttcaatttcgatgccgagttcaaattgttacgctttcaataattcaagtcgaattgtt |
32596837 |
T |
 |
| Q |
118 |
gatttcgtatccttcatttccacatgcttcaagttttcaacttttattaggcattgcattttaacgttactaattgcaaatgggtcattattggattcta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32596836 |
gatttcgtatccttcatttccacatgcttcaagttttcaacttttattaggcattgcattttaacgttactaattgcaaatgggtcattattggattcta |
32596737 |
T |
 |
| Q |
218 |
attttagtatattatggatgtttttt |
243 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
32596736 |
attttagtatattatggatgtttttt |
32596711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University