View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1553_low_11 (Length: 284)
Name: NF1553_low_11
Description: NF1553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1553_low_11 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 9 - 284
Target Start/End: Original strand, 42823708 - 42823993
Alignment:
| Q |
9 |
acatcatcatcatttgattcatcatttcagcttaaaatgaaacgaagattgttttgtttcattttagctctgcagttactaagttctgtctctgtggcta |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42823708 |
acatcatcatcatttgattcatcatttcagcttaaaatgaaaggaagattgttttgtttcattttagctctgcagttactaagttctgtctctgtggcta |
42823807 |
T |
 |
| Q |
109 |
aaagggcttttccttcaactgatgcaatgtcacatccaggtaat----------tagcacaccatttttatagatatagaccttaatttaatcattggta |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| ||| |
|
|
| T |
42823808 |
aaagggcttttccttcaactgatgcaatgtcacatccaggtaattagttaaccatagcacaccatttttatagatatataccttaatttaatcattagta |
42823907 |
T |
 |
| Q |
199 |
tttttaagtactaacaactgatatatgcttcatttgtattttgtatatatgatgattaggcccagcagagacaccagcaccacacc |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
42823908 |
tttttaagtactaacaactgatatatgcttcatttgtattttgtatatatgatgattaggcccaggagaggcaccagcaccacacc |
42823993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University