View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1553_low_26 (Length: 233)
Name: NF1553_low_26
Description: NF1553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1553_low_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 39 - 220
Target Start/End: Original strand, 23544976 - 23545157
Alignment:
| Q |
39 |
attgaacaactttcaaagattaatcatccaattgaaagnnnnnnnncttcccaaacttat-gtaatcgatttattcataacatttttaaaaagaagatat |
137 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23544976 |
attgaacaactttcaaacattaatcatccaattgaaa-aagaaaaacttcccaaacttatagtaatcgatttattcataacatttttagaaagaagatat |
23545074 |
T |
|
| Q |
138 |
ttcatcatagtcataacatgcttcctcatctcatataaaatcatgaggacaagtgagttccataaaataaacaaactaaagta |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23545075 |
ttcatcatagtcataacatgcttcctcatctcatatcaaatcatgaggacaagtgagttccataaaataaacaaactaaagta |
23545157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University