View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15540_high_10 (Length: 255)
Name: NF15540_high_10
Description: NF15540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15540_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 88; Significance: 2e-42; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 105 - 228
Target Start/End: Complemental strand, 32737835 - 32737711
Alignment:
| Q |
105 |
gaaaagtcacagatatataatttgttttccagtactgcttccttgttatttgtataaatatg-nnnnnnncataagcaaatgttatataaacctcattgc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
32737835 |
gaaaagtcacagatatataatttgttttccagtactgcttccttgttatttgtataaatatgttttttttcataagcaaatgttatataaaccttattgc |
32737736 |
T |
|
| Q |
204 |
aatttatatcaacatatctcttatg |
228 |
Q |
| |
|
|||||||||| |||||||||||||| |
|
|
| T |
32737735 |
aatttatatctacatatctcttatg |
32737711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 105 - 228
Target Start/End: Complemental strand, 32740362 - 32740231
Alignment:
| Q |
105 |
gaaaagtcacagatatataatttgttttccagtactgcttccttgttatttgtataaatatgnnnnnnncataagcaaatg------ttatataaacctc |
198 |
Q |
| |
|
||||||| ||||| |||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
32740362 |
gaaaagttgcagatgtatactttgttttccagtactgcttccttgttatttgtataaatatgtttttttaataagcaaatgttatacttatataaacctc |
32740263 |
T |
|
| Q |
199 |
attgcaattta--tatcaacatatctcttatg |
228 |
Q |
| |
|
|||| |||||| |||| |||||||||||||| |
|
|
| T |
32740262 |
attgtaatttatgtatccacatatctcttatg |
32740231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 32737940 - 32737893
Alignment:
| Q |
1 |
ttgtcatattttgatatgttaatactgcagaatgcagatctaatgcaa |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32737940 |
ttgtcatattttgatatgttaatactgcagaatgcagatctaatgcaa |
32737893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University