View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15540_low_16 (Length: 236)
Name: NF15540_low_16
Description: NF15540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15540_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 21 - 220
Target Start/End: Original strand, 32738023 - 32738222
Alignment:
| Q |
21 |
acacaaatagtcttcaataatgaatgaacgttaaccctttcatcaaggtgcatgtgtctcaccttgaaagagagcttcattgattgtttgcaacaccaaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32738023 |
acacaaatagtcttcaataatgaatgaacgataaccctttcatcaaggtgcatgtgtctcaccttgaaagagagcttcattgattgtttgcaacaccaaa |
32738122 |
T |
 |
| Q |
121 |
tggaacaaaaagacggggataacctcgacgctgatgaatgtttccggcgacattcatttctttcagagggcagtttgtgccaccacttccggggataaag |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32738123 |
tggaacaaaaagacggggataacctcgacgctgatgaatgtttccggcgacattcatttctttcagagggcagtttgtgccaccacttccggggataaag |
32738222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 21 - 185
Target Start/End: Original strand, 32740539 - 32740702
Alignment:
| Q |
21 |
acacaaatagtcttcaataatgaatgaacgttaaccctttcatcaaggtgcatgtgtctcaccttgaaagagagcttcattgattgtttgcaacaccaaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32740539 |
acacaaatagtcttcaataatgaatgaaatttaaccctttcatcaaggtgcatgtgtctcaccttgaaagagatcttcattgattgtttgcaacaccaaa |
32740638 |
T |
 |
| Q |
121 |
tggaacaaaaagacggggataacctcgacgctgatgaatgtttccggcgacattcatttctttca |
185 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
32740639 |
tggaacaaaaagac-gggataacctcgacgctgatgagtgtttccggcgacattcatttccttca |
32740702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University