View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15540_low_18 (Length: 201)
Name: NF15540_low_18
Description: NF15540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15540_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 7e-48; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 33344671 - 33344563
Alignment:
| Q |
1 |
gatgatcactagttccaaactgtgatgactgatgatagtgtcaaaaccttttattttgataacccttctgttagataaaggttcaattttgtgattagat |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33344671 |
gatgatcactagttccaaattgtgatgactgatgatagtgtcaaaaccttggattttgataacccttctgttagataaaggttcaattttgtgattagat |
33344572 |
T |
 |
| Q |
101 |
ttagggggc |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
33344571 |
ttagggggc |
33344563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 33333051 - 33332980
Alignment:
| Q |
1 |
gatgatcactagttccaaactgtgatgactgatgatagtgtcaaaaccttttattttgataacccttctgtt |
72 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33333051 |
gatgatcactagtttcaaattgtgatgactgatgatagtgtcaaaaccttggattttgataacccttctgtt |
33332980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University