View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15540_low_8 (Length: 338)
Name: NF15540_low_8
Description: NF15540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15540_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 19 - 303
Target Start/End: Original strand, 38631864 - 38632148
Alignment:
| Q |
19 |
cttctgctaggtaaggcagctttgttgtttttggtgcatattgttttaattggtaaactaaagattgagaatgctaaaagggagaagctggctctagaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38631864 |
cttctgctaggtaaggcagctttgttgtttttggtgcatattgttttaattggtaaactaaagattgagaatgctaaaagggagaagctggctctagaaa |
38631963 |
T |
 |
| Q |
119 |
ttgttttggtgtgtatgggaggatacagaaggaaggtatactaagggggaatgatagttttgggttgagtttgactgtcaggtttcggattatttagttc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38631964 |
ttgttttggtgtgtatgggaggatacagaaggaaggtatactaagggggaatgatagttttgggttgagtttgactgtcaggtttgggattatttagttc |
38632063 |
T |
 |
| Q |
219 |
aactttgaatataagttatacctactaactactgattagtaagaggatgaaaaatcaacatcaacgaggatacaatgcaagagat |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38632064 |
aactttgaatataagttatacctactaactactgattagtaagaggatgaaaaatcaacatcaacgaggatacaatgcaagagat |
38632148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University